Basic Information
| ANNInter ID | ANNInter97820 |
|---|---|
| Interaction Type | tsRNA - circRNA |
| Identification Method(s) | RNAhybrid;IntaRNA |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr006774 | ath_circ_046833 |
| Category | tsRNA | circRNA |
| Coordinate | Pt:427-40340(.) | |
| Interaction Sequence | UCCCCGCUGCCUCCUUGAAAGAGAGAUGUCCUGAAC | GUUCAGGACAUCUCUCUUUCAAGGAGGCAGCGGGGA |
| Interaction Site | 1.0-36.0;30060.0-30095.0 | 1.0-36.0;30060.0-30095.0 |