Basic Information


ANNInter ID ANNInter96637
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr009488 URS0002398F99_3702
Category tsRNA lncRNA
Coordinate
Interaction Sequence UGAGCUGUGAAGAAAUUGGCUU CUUCCAAUAUCUUCACAGCUUC
Interaction Site 1 - 22 994 - 1015

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network