Basic Information


ANNInter ID ANNInter95602
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr009266 URS0002376853_3702
Category tsRNA lncRNA
Coordinate 1:7453566-7546337(+)
Interaction Sequence UUGGACUCUGAAUCCAGUAACCC AGGUCGCUGGAUUCAAAGUCCAG
Interaction Site 1 - 23 46191 - 46213

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network