Basic Information
| ANNInter ID | ANNInter95556 |
|---|---|
| Interaction Type | tsRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr009226 | ath_circ_021333 |
| Category | tsRNA | circRNA |
| Coordinate | 3:4151608-4154273(+) | |
| Interaction Sequence | UUGACUGCAG-AUCAAUAGGUCACC | UUUGGCUUGUUGGUACUGCAGUUAA |
| Interaction Site | 1 - 24 | 2446 - 2470 |