Basic Information


ANNInter ID ANNInter95489
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr009185 URS00024167BD_3702
Category tsRNA lncRNA
Coordinate 3:17231786-17323918(+)
Interaction Sequence UUCUAAUCAAGCGAUUGUGGGU AUCGAGGAUCGUUUGGUUAGGA
Interaction Site 1 - 22 19632 - 19653

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network