Basic Information
| ANNInter ID |
ANNInter95408 |
| Interaction Type |
tsRNA - lncRNA |
| Identification Method(s) |
psRNATarget |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath_tsr009180 |
URS000240294D_3702 |
| Category |
tsRNA |
lncRNA |
| Coordinate |
|
|
| Interaction Sequence |
UUCUAAUCAAACGAUUGUGGG |
ACUGCAAUCUUUUGGUUGGGA |
| Interaction Site |
1 - 21 |
34339 - 34359 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
Cleavage |
| RNAhybrid MFE |
NA |
| IntaRNA MFE |
NA |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|