Basic Information


ANNInter ID ANNInter95297
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr009165 URS000241EF5E_3702
Category tsRNA lncRNA
Coordinate 3:13593567-13682963(+)
Interaction Sequence UUCGAUUCCCUGGAUGCGCACCA UGAUACUCGACCAGGGGGUCGAG
Interaction Site 1 - 23 36241 - 36263

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network