Basic Information


ANNInter ID ANNInter95269
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr009162 URS00023BDC54_3702
Category tsRNA lncRNA
Coordinate 4:18229100-18268809(+)
Interaction Sequence UUCGAUUCCCGGCUGGUGCACCA UGCUGCACCAGCAGGUAAUUGGG
Interaction Site 1 - 23 7764 - 7786

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network