Basic Information


ANNInter ID ANNInter94952
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr009121 URS00023936CA_3702
Category tsRNA lncRNA
Coordinate 2:4225748-4312019(+)
Interaction Sequence UUCGACUCCGUCCUUGGCCUCCA GUGGGGGCGAGUGCGGAGUUGAA
Interaction Site 1 - 23 14337 - 14359

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network