Basic Information


ANNInter ID ANNInter94085
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr008962 URS0000A76FC2_3702
Category tsRNA lncRNA
Coordinate 3:23352294-23352511(+)
Interaction Sequence UUAUAUUGUAGGUUCGAGCCCU GGAAGUCGAAUCUGUAAUAUAA
Interaction Site 1 - 22 135 - 156

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network