Basic Information


ANNInter ID ANNInter93954
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr008913 ath_circ_002098
Category tsRNA circRNA
Coordinate 1:3837298-4222580(.)
Interaction Sequence UUAGGAUACUCGGCUC-UCACCCGA UUGGAUGAUGAGCCGAGUAUUCCAA
Interaction Site 1 - 24 271958 - 271982

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network