Basic Information
| ANNInter ID | ANNInter93853 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr008885 | URS000237E6D3_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 1:7453734-7530251(+) | |
| Interaction Sequence | UUAGGACAUUGGACUCUGAAUCCAG | CUGGAUUCAAAGUCCAGAGUGCUAA |
| Interaction Site | 1 - 25 | 46029 - 46053 |