Basic Information


ANNInter ID ANNInter91369
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr008406 URS0002351089_3702
Category tsRNA lncRNA
Coordinate 4:438642-470423(+)
Interaction Sequence UGGACUCUGAAUCCAGUAACCCGA CCUAGUUACUGGGUUUGGAAUCCA
Interaction Site 1 - 24 3336 - 3359

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network