Basic Information


ANNInter ID ANNInter91111
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr008308 URS0002365061_3702
Category tsRNA lncRNA
Coordinate 1:12011013-12023567(+)
Interaction Sequence UCUUUUCAUGUCGAAGACACGGG AUCUUGUUUUUGGCAUGAACAGA
Interaction Site 1 - 23 6349 - 6371

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network