Basic Information


ANNInter ID ANNInter90304
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr008091 URS000238F7DE_3702
Category tsRNA lncRNA
Coordinate 4:9489541-9548552(+)
Interaction Sequence UCGCAAGGCUCAUAACCUUGAGG GGUCAAUCUCAUGAGCCUUGAGA
Interaction Site 1 - 23 2000 - 2022

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network