Basic Information
| ANNInter ID | ANNInter90088 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | psRNATarget;RNAhybrid;IntaRNA |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr008072 | URS00023647D7_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 1:11164499-11215986(+) | |
| Interaction Sequence | UCGAUUCCCGCUAUCCGCCCCA | CGGGUUGGAAAGCGGGAAUUGA |
| Interaction Site | 1 - 22 | 12621 - 12642 |