Basic Information


ANNInter ID ANNInter89600
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr008005 ath_circ_024385
Category tsRNA circRNA
Coordinate 3:12785246-13033365(.)
Interaction Sequence UCGAAUCCGGUUGGGCUCUCCA AGGGGACUUCGACCGGAUUUGA
Interaction Site 1 - 22 70579 - 70600

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network