Basic Information


ANNInter ID ANNInter89346
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr007935 URS0002420469_3702
Category tsRNA lncRNA
Coordinate Mt:10967-43636(+)
Interaction Sequence UCCUCAGUAGCUCAGUGGUAGAG UCCUGCUGUUGAGCUACUGGGGA
Interaction Site 1 - 23 6245 - 6267

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network