Basic Information


ANNInter ID ANNInter89148
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr007835 ath_circ_018642
Category tsRNA circRNA
Coordinate 2:18944937-19026267(.)
Interaction Sequence UCCGUUAUCGUCCAGCGGUUAGGAU ACUCUGAUCGCUAGAUGGAAACGGA
Interaction Site 1 - 25 37163 - 37187

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network