Basic Information


ANNInter ID ANNInter89045
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr007766 URS0000A7746D_3702
Category tsRNA lncRNA
Coordinate 2:13856123-13856487(+)
Interaction Sequence UCCGAUGUCGUCCAGCGGUUAGG GGUUUGGUCUGGACGACAUCGGA
Interaction Site 1 - 23 7 - 29

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network