Basic Information


ANNInter ID ANNInter88949
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr007662 URS00023B6319_3702
Category tsRNA lncRNA
Coordinate 1:27616916-27623582(+)
Interaction Sequence UCCAUUGUCGUCCAGCGGUU GACUGCUGAAUGACAGUGCA
Interaction Site 1 - 20 4405 - 4424

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network