Basic Information


ANNInter ID ANNInter88476
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr007586 URS0002428D67_3702
Category tsRNA lncRNA
Coordinate 3:13593565-13682963(+)
Interaction Sequence UCAGGAUACUCGGCUCUCACCCG GACCAGGGGGUCGAGUAACUUGG
Interaction Site 1 - 23 28672 - 28694

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network