Basic Information


ANNInter ID ANNInter88350
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr007556 ath_circ_047946
Category tsRNA circRNA
Coordinate Pt:1717-136972(.)
Interaction Sequence UCAGGACAUCUCUCUUUCAAGGAG CUCCUUGAAAGAGAGAUGUCCUGA
Interaction Site 1 - 24 28780 - 28803

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network