Basic Information


ANNInter ID ANNInter87975
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr007491 ath_circ_046954
Category tsRNA circRNA
Coordinate Pt:493-136643(.)
Interaction Sequence UCAAAUCCUGUCUCCGCAACCA AAGUUGCGGAGACAGGAUUUGA
Interaction Site 1 - 22 36209 - 36230

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network