Basic Information
| ANNInter ID | ANNInter87712 |
|---|---|
| Interaction Type | tsRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr007429 | ath_circ_018411 |
| Category | tsRNA | circRNA |
| Coordinate | 2:18498654-18660105(.) | |
| Interaction Sequence | UAUGAUUCUCGCUUUGGGUGCGAGA | AAUCGUAUCCAGAUCGGGAAUCGUA |
| Interaction Site | 1 - 25 | 89373 - 89397 |