Basic Information
| ANNInter ID | ANNInter86769 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | RNAhybrid;IntaRNA |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr007238 | URS0002385494_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 2:6950158-6960925(+) | |
| Interaction Sequence | GCUGGUUAGGAUACUCGGCUCUCACCCGAGAGACCC | GGGUUUCCGGGUCGGGUCGAGUAUCCGUCUUAGU |
| Interaction Site | 3 - 38 | 2641 - 2674 |