Basic Information
                    
                    
                    
                    
                      | ANNInter ID | ANNInter86497 | 
                    
                      | Interaction Type | tsRNA - circRNA | 
                    
                      | Identification Method(s) | psRNATarget | 
                    
                     
                     
                    Interaction Information
                    
                    
                    
                    
                      | Type | ncRNA Interactor 1 | ncRNA Interactor 2 | 
                    
                      | ncRNA ID | ath_tsr007189 | ath_circ_031765 | 
                    
                      | Category | tsRNA | circRNA | 
                    
                      | Coordinate |  | 4:10842919-10843774(+) | 
                    
                      | Interaction Sequence | UAGCGGUUAGGACAUUGGACU | AGUUCGAUGUUCUAGUCCCUA | 
                    
                      | Interaction Site | 1 - 21 | 626 - 646 | 
                    
                     
		     
    Additional Information
    
    
    
    
      | Unpaired Energy (UPE) | NA | 
    
      | Inhibition Mode | Cleavage | 
    
      | RNAhybrid MFE | NA | 
    
      | IntaRNA MFE | NA | 
    
      | Degradome Support | No | 
    
      | Allen's Score | NA | 
    
      | Category | NA | 
    
  | Sample IDs |  |