Basic Information
| ANNInter ID | ANNInter86315 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr007153 | URS0002421C10_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 1:7436018-7446992(+) | |
| Interaction Sequence | UAGACUCUGAAUCUAGUAACCCGAG | UUCGGCUAGUUAGAUCCAGAGUUUG |
| Interaction Site | 1 - 25 | 9230 - 9254 |