Basic Information
| ANNInter ID | ANNInter85297 |
|---|---|
| Interaction Type | tsRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr006927 | ath_circ_004006 |
| Category | tsRNA | circRNA |
| Coordinate | 1:8220612-8222570(+) | |
| Interaction Sequence | GUUGUAGUAUAGUGGUAAGUAUUCC | UCAAUAUUUACCACAAUACAACGAU |
| Interaction Site | 1 - 25 | 1771 - 1795 |