Basic Information


ANNInter ID ANNInter84903
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr006852 ath_circ_043668
Category tsRNA circRNA
Coordinate 5:21064186-21065063(-)
Interaction Sequence GUUCGAUCCACGCUCACCGCACCA UGUUGCGAUGAGCAAGGAUCGAAA
Interaction Site 1 - 24 273 - 296

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network