Basic Information


ANNInter ID ANNInter84701
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr006820 URS00023E04C9_3702
Category tsRNA lncRNA
Coordinate 1:7453571-7536335(+)
Interaction Sequence GUUCGACUCCCGGUAGAACCUCCA GAAAGGUCCUACCGGGAGUCGAAC
Interaction Site 1 - 24 46160 - 46183

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network