Basic Information
| ANNInter ID | ANNInter84207 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | RNAhybrid;IntaRNA |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr006754 | URS00023FF51B_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 1:7453679-7454957(+) | |
| Interaction Sequence | GUUCAAGUCCCUCCUUCCGCUCCA | UGGAGGAGGAGGAGGUGAUUUGUAC |
| Interaction Site | 1 - 24 | 84 - 108 |