Basic Information
| ANNInter ID |
ANNInter84176 |
| Interaction Type |
tsRNA - lncRNA |
| Identification Method(s) |
RNAhybrid;IntaRNA |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath_tsr006754 |
URS0000A76BAB_3702 |
| Category |
tsRNA |
lncRNA |
| Coordinate |
|
1:8071789-8074296(+) |
| Interaction Sequence |
AGUCCCUCCUUCCGCUCCA |
UGGAGCGGGAAGGAGGGAUU |
| Interaction Site |
6 - 24 |
896 - 915 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
NA |
| RNAhybrid MFE |
-40.7 |
| IntaRNA MFE |
-28.85 |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|