Basic Information
| ANNInter ID | ANNInter84067 |
|---|---|
| Interaction Type | tsRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr006744 | ath_circ_019514 |
| Category | tsRNA | circRNA |
| Coordinate | 3:918110-1180171(.) | |
| Interaction Sequence | GUUCAAAUCUCGGUAGG-ACCUCCA | UGGAAGUAUCUACCAAGAUUUGAAC |
| Interaction Site | 1 - 24 | 187638 - 187662 |