Basic Information


ANNInter ID ANNInter83913
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr006716 ath_circ_046497
Category tsRNA circRNA
Coordinate Mt:259964-287975(.)
Interaction Sequence GUUCAAAUCCAAUAGUAGGUACCA UUCUAGCUACUAUUGGAUUUGAAC
Interaction Site 1 - 24 9303 - 9326

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network