Basic Information
| ANNInter ID | ANNInter83190 |
|---|---|
| Interaction Type | tsRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr006544 | ath_circ_023823 |
| Category | tsRNA | circRNA |
| Coordinate | 3:9440123-9448315(.) | |
| Interaction Sequence | GUGGUCUAGUGGUAGA--AUAGUAC | GUACCAUGGUCUACCACUAGACCAU |
| Interaction Site | 1 - 23 | 614 - 638 |