Basic Information


ANNInter ID ANNInter81688
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr006216 URS0000A765FD_3702
Category tsRNA lncRNA
Coordinate 3:11586005-11586548(-)
Interaction Sequence GUCCCGAGUUCAAUUCUCGGA AUUGAGAGUUGAACUCAAGAC
Interaction Site 1 - 21 343 - 363

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network