Basic Information


ANNInter ID ANNInter81568
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr006159 URS0002398D15_3702
Category tsRNA lncRNA
Coordinate 3:13593570-13685006(+)
Interaction Sequence GUCAGGAUACUCGGCUCUCA AGGGGGUCGAGUAACUUGGU
Interaction Site 1 - 20 28671 - 28690

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network