Basic Information


ANNInter ID ANNInter80790
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr005942 URS0000A777E4_3702
Category tsRNA lncRNA
Coordinate 5:19625384-19625721(+)
Interaction Sequence GGUUCGAUUCCCGGCUGGUGCACC GAUGCAUUAGUCGGGACUCGGGCG
Interaction Site 1 - 24 143 - 166

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network