Basic Information
| ANNInter ID | ANNInter80713 | 
|---|---|
| Interaction Type | tsRNA - lncRNA | 
| Identification Method(s) | psRNATarget | 
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 | 
|---|---|---|
| ncRNA ID | ath_tsr005932 | URS000235E7DF_3702 | 
| Category | tsRNA | lncRNA | 
| Coordinate | ||
| Interaction Sequence | GGUUCGAUCCCCAGCAGAGUCGCCA | UUGUGGUUCUGUUUGGGAUUGUACU | 
| Interaction Site | 1 - 25 | 7725 - 7749 |