Basic Information


ANNInter ID ANNInter80166
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr005852 ath_circ_016315
Category tsRNA circRNA
Coordinate 2:14269835-14271322(+)
Interaction Sequence GGUUCAAAUCCGAUAAGGGGCU UUCCUCUUAUCGGUUUUGAACA
Interaction Site 1 - 22 227 - 248

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network