Basic Information


ANNInter ID ANNInter80074
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr005842 ath_circ_046497
Category tsRNA circRNA
Coordinate Mt:259964-287975(.)
Interaction Sequence GGUUCAAAUCCAAUAGUAGGUAC CUAGCUACUAUUGGAUUUGAACC
Interaction Site 1 - 23 9305 - 9327

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network