Basic Information


ANNInter ID ANNInter79348
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr005665 ath_circ_002324
Category tsRNA circRNA
Coordinate 1:4393546-4393850(-)
Interaction Sequence GGUCAGGAUACUCGGCUCUC GAGAGCUGAGUCUCCUGAAG
Interaction Site 1 - 20 63 - 82

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network