Basic Information


ANNInter ID ANNInter78856
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr005509 URS0000A768E6_3702
Category tsRNA lncRNA
Coordinate 2:9432221-9432641(-)
Interaction Sequence GGGUCCUUAGCUCAGUGGUAGAGCA UCUUUUAUCUCUUAGCUAAGGACUU
Interaction Site 1 - 25 298 - 322

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network