Basic Information
| ANNInter ID | ANNInter78400 |
|---|---|
| Interaction Type | tsRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr005448 | ath_circ_047536 |
| Category | tsRNA | circRNA |
| Coordinate | Pt:934-135929(.) | |
| Interaction Sequence | GGGGCGUAGCCAAGCGGUAAGGCAA | UUGCCUUACCGCUUGGCUACGCCCC |
| Interaction Site | 1 - 25 | 5729 - 5753 |