Basic Information


ANNInter ID ANNInter78191
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr005420 ath_circ_036905
Category tsRNA circRNA
Coordinate 5:2417302-2460064(.)
Interaction Sequence GGGGAUGUAGCUCAGAUGGUAGAG CUCUACCAUCUGAGCUACAUCCCC
Interaction Site 1 - 24 15011 - 15034

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network