Basic Information


ANNInter ID ANNInter77965
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr005384 URS000235F4ED_3702
Category tsRNA lncRNA
Coordinate 3:10653656-10703428(+)
Interaction Sequence GGGCUUGUAGCUCAGAGGAU GUUUUUUGAGUUAUGAGUCC
Interaction Site 1 - 20 12702 - 12721

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network