Basic Information


ANNInter ID ANNInter77833
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr005358 URS000239E017_3702
Category tsRNA lncRNA
Coordinate 3:9356139-9430187(+)
Interaction Sequence GGGCUAUUAGCUCAGU--GGUAGAGCG CGCUCUAACCAACUGAGCUAAUAGGCC
Interaction Site 1 - 25 16283 - 16309

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network