Basic Information
| ANNInter ID | ANNInter76822 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | RNAhybrid;IntaRNA |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr005163 | URS00023BE276_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 4:15266424-15272015(+) | |
| Interaction Sequence | GGCGGCAUGGCCGAGUGGUAAGGCGGGGGA | UCUGCCCCUACUGCUAUUCGAGCUGCUGCC |
| Interaction Site | 1 - 30 | 3847 - 3876 |