Basic Information


ANNInter ID ANNInter76301
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr005093 ath_circ_046350
Category tsRNA circRNA
Coordinate Mt:10920-363277(.)
Interaction Sequence GGAUUAAGGCAGUGGAUUGUGAAU AUUCACAAUCCACUGCCUUGAUCC
Interaction Site 1 - 24 348781 - 348804

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network